Thrombopoietin Levels in Patients with Cirrhosis before and after Orthotopic Liver Transplantation

  1. Thomas G. Martin III, MD;
  2. Kenneth A. Somberg, MD;
  3. Y. Gloria Meng, PhD;
  4. Robert L. Cohen, MD;
  5. Christian A. Heid;
  6. Frederic J. de Sauvage, PhD; and
  7. Marc A. Shuman, MD
  1. From the University of California, San Francisco, California, and Genentech. Inc., South San Francisco. California. Acknowledgment: The authors thank Robert S. Warren, MD, Assistant Professor in Residence, Department of Surgery, University of California, San Francisco, for providing the normal liver tissue samples. Grant Support: In part by grant HL54476 from the National Institutes of Health and by Genentech, Inc. Requests for Reprints: Thomas G. Martin III, MD, Division of Hematology, University of California, San Francisco, Medical Center, Box 1270, Parnassus Avenue, San Francisco, CA 94143. Current Author Addresses: Dr. Martin: Division of Hematology, University of California, San Francisco, Medical Center, Box 1270, Parnassus Avenue, San Francisco, CA 94143.

    Abstract

    Background: Thrombocytopenia is a common manifestation of cirrhosis.

    Objectives: To determine plasma thrombopoietin levels in cirrhotic patients with thrombocytopenia, monitor those levels before and after orthotopic liver transplantation, and compare thrombopoietin messenger RNA (mRNA) levels in liver samples from cirrhotic patients and controls.

    Design: A cross-sectional study of patients with cirrhosis, including a small subset of patients who had orthotopic liver transplantation.

    Setting: University-affiliated hospital.

    Patients: 44 patients with cirrhosis, including 17 patients who had orthotopic liver transplantation.

    Intervention: Orthotopic liver transplantation.

    Measurements: Plasma thrombopoietin levels in all patients, platelet counts in all patients, and thrombopoietin mRNA levels in liver samples from nine patients with cirrhosis and eight controls.

    Results: Thrombopoietin levels were undetectable in 39 of 44 patients with cirrhosis. In 16 of 17 patients, the levels became detectable after liver transplantation. Thrombopoietin mRNA levels were decreased in liver samples from patients with cirrhosis compared with controls (P = 0.0103).

    Conclusions: The low thrombopoietin levels in cirrhotic patients with thrombocytopenia and the increased levels after orthotopic liver transplantation suggest that impaired production of thrombopoietin may contribute to thrombocytopenia associated with cirrhosis.

    Thrombocytopenia in patients with cirrhosis has historically been attributed to hypersplenism. Radiolabeled platelet studies have clearly demonstrated splenic sequestration in cirrhosis and have shown that up to 90% of platelets can localize to the spleen [1-3]. However, portal decompression procedures have failed to consistently improve thrombocytopenia [4-7] and thrombocytopenia can persist after splenectomy [8]. Therefore, other factors must be involved.

    Thrombopoietin is a potent stimulator of megakaryocyte growth and platelet production [9]. Synthesis of thrombopoietin probably occurs in the liver [10]. In this study, we measured plasma thrombopoietin levels in cirrhotic patients who had thrombocytopenia and evaluated changes in these levels throughout orthotopic liver transplantation. Levels of messenger RNA (mRNA) in thrombopoietin in liver samples taken from patients with cirrhosis and controls were compared. Our hypothesis was that production of thrombopoietin is altered in patients with cirrhosis and that impaired transcription of thrombopoietin mRNA may contribute to this alteration.

    Methods

    Two separate convenience samples taken from patients with cirrhosis (17 patients who had and 27 patients who did not have orthotopic liver transplantation) were recruited from the gastroenterology services at the University of California, San Francisco, Medical Center. All 44 patients had persistent or stable thrombocytopenia for more than 2 weeks (platelet count < 120 000 cells/microL). Patients with acute intercurrent illnesses were excluded.

    Patients were selected for transplantation on the basis of standard criteria (severity of disease and organ availability). These patients received an ABO-matched cadaver liver and standard post-transplantation immunosuppressive drugs, including corticosteroids, azathioprine, and cyclosporine. Approval was obtained from the Committee on Human Research at the University of California, San Francisco: all patients provided informed consent. The enrollment period was from June 1995 through April 1996.

    The 27 patients with cirrhosis who did not have transplantation provided one random plasma sample. The 17 patients who had orthotopic liver transplantations had plasma samples taken before transplantation; within 4 to 12 hours after transplantation; and every Monday, Wednesday, and Friday thereafter until discharge or until the platelet count was normal. This schedule was adopted from previous studies of patients who had bone marrow transplantation [11]. Platelet counts were obtained daily for all 17 patients until discharge, as per standard protocol for orthotopic liver transplantation. The samples were frozen at −80°C before being measured.

    Two enzyme-linked immunosorbent assays (ELISAs) were used during the study. The initial assay used a chimeric molecule that consisted of c-mpl extracellular domain fused to the Fc portion of human immunoglobulin for capture and a rabbit polyclonal antibody to thrombopoietin for detection. The second was a murine antithrombopoietin monoclonal antibody sandwich-type assay. The detection limits of the assays were 160 and 40 pg/mL, respectively. The second ELISA was available for the final 13 patients with cirrhosis and 10 patients who had liver transplantation.

    Cirrhotic liver samples were obtained from explanted livers during surgery (n = 9). Samples of livers from controls were obtained during partial hepatectomy for localized metastases of colon cancer (n = 5) or primary liver cancer (n = 2; 1 patient had leiomyosarcoma, and 1 had hepatoma) and during orthotopic liver transplantation for hereditary hyperoxaluria (n = 1). Liver tissue was obtained from areas of normal-appearing parenchyma. All patients had normal platelet counts, prothrombin times, and aminotransferase levels. Samples were snap-frozen in liquid nitrogen and stored at −80°C.

    Total RNA was isolated from cryopreserved liver tissue by using the ULTRASPEC RNA Isolation System (Biotecx Lab, Houston, Texas) according to the manufacturer's instructions. Reverse-transcription polymerase chain reaction (PCR) was done using 100 ng of total RNA, a thrombopoietin-specific reverse primer, and the Promega Access RT-PCR system (Promega, Madison, Wisconsin). The Perkin Elmer 7700 Sequence Detector System (Perkin Elmer, Foster City, Caliornia) was used for DNA amplification as described elsewhere [12]. The thrombopoietin-specific forward primer was 5′GCCAAGATTCCTGGTCTGCTGAAC3′, and the reverse primer was 5′GCTGATGTCGGCAGTGTCTGAGAA3′. A fluorogenic probe specific for thrombopoietin (5′FAM-TGCCTGGACCAAATCCCGGATACCTGAA3′) was added to the PCR amplification. Repetitive cycles resulted in increasing release of fluorescence. System software used fluorescence intensity to determine mRNA levels in thrombopoietin and in glyceraldehyde-3-phosphate dehydrogenase (a housekeeping gene).

    Funding provided by the National Institutes of Health and Genentech. Inc., had no influence on design of the study, conduct of the study, or reporting of the findings.

    Results

    Selected patient characteristics are shown in the (Table 1). All patients had moderate-to-severe liver dysfunction. Thrombocytopenia was profound in most patients; 21 patients had platelet counts less than 50 000/µL, and 6 patients had counts less than 30 000/µL. All 17 patients had successful transplantation without serious complications. Liver biopsies were done approximately 8 days (range, 6 to 16 days) after transplantation. Results showed no evidence of acute rejection (11 patients), mild rejection (4 patients), or moderate rejection (2 patients). Preservation injury was mild to moderate in all 17 patients, and all 17 had improved liver function after transplantation (data not shown).

    Table 1. Patient Characteristics

    Baseline levels of thrombopoietin were undetectable in 39 of 43 patients with cirrhosis. The mean detectable level of thrombopoietin was 130 pg/mL in 5 patients, and all levels were less than 200 pg/mL. In patients who had orthotopic liver transplantation, the mean interval to first detection of thrombopoietin was about 3 days and peak levels occurred about 8 days after transplantation. Peak concentrations of thrombopoietin varied considerably (46 to 2541 pg/mL), with a mean peak value of 492 pg/mL (median, 339 pg/mL). Platelet counts increased during or immediately after peak concentrations of thrombopoietin. Thrombocytopenia completely resolved in all 17 patients within 23 days after transplantation (10 patients before discharge, and 7 patients after discharge). As platelet counts reached normal levels, most patients (8 of 10) developed low or undetectable levels of thrombopoietin. A representative graph of thrombopoietin levels and platelet counts in 1 patient who had orthotopic liver transplantation is shown in the (Figure 1).

    Figure 1. Representative values from one patient who had orthotopic liver transplantation are shown. Values on day 0 were measured before transplantation. Transplantation was done on day 0. The dotted horizontal line represents the detection limit of the thrombopoietin assay. OLT = orthotopic liver transplantation; TPO = thrombopoietin.
    View larger version:
      Figure 1. Representative values from one patient who had orthotopic liver transplantation are shown. Values on day 0 were measured before transplantation. Transplantation was done on day 0. The dotted horizontal line represents the detection limit of the thrombopoietin assay. OLT = orthotopic liver transplantation; TPO = thrombopoietin. Serial thrombopoietin levels and platelet counts before and after orthotopic liver transplantation.

      The ratio of thrombopoietin mRNA transcript levels to glyceraldehyde-3-phosphate dehydrogenase mRNA transcript levels was 0.264 in cirrhotic liver samples and 0.357 in control liver samples. Results are expressed as ratios to control for the number of liver cells. Thrombopoietin mRNA transcript levels were 26% lower in cirrhotic liver samples than in control liver samples (unpaired t-test, P = 0.0103 [95% CI, 0.025 to 0.161]).

      Discussion

      The mechanism (or mechanisms) responsible for homeostasis of thrombopoietin has not been fully elucidated. One model proposes that regulation occurs solely through binding of thrombopoietin to receptors on platelets [13, 14]. Receptors have the ability to bind, internalize, and degrade thrombopoietin. When platelet counts are normal (>140 000/microL), most thrombopoietin is bound to receptors and plasma levels are low. When platelet counts are low (<140 000 cells/microL), few receptors are available for binding with thrombopoietin and plasma levels increase. Elevated levels of thrombopoietin then stimulate megakaryopoiesis and platelet production. This model establishes an inverse relation between thrombopoietin levels and platelet counts. We previously [11] reported undetectable levels of thrombopoietin (<160 pg/mL) in plasma in 88 of 89 healthy persons and markedly increased plasma thrombopoietin levels in 58 of 61 patients with cancer and thrombocytopenia (mean thrombopoietin level, 1095 pg/mL); these findings support an inverse relation.

      On the basis of this model, we expected elevated levels of thrombopoietin in cirrhotic patients who had thrombocytopenia. On the contrary, we found low or undetectable levels, which suggests that thrombopoietin levels and platelet counts are not inversely related in patients with cirrhosis. Several explanations may account for this. One hypothesis is that synthesis of thrombopoietin is impaired in cirrhotic livers. Defective production of thrombopoietin results in lower serum levels, decreased megakaryopoiesis, and lower platelet counts. Another explanation is that hypersplenism causes thrombocytopenia and production of thrombopoietin is normal. As a result, thrombopoietin is bound to platelets and both are sequestered in the spleen. The persistent thrombocytopenia found in patients with cirrhosis after splenectomy or portal decompression procedures argues against this explanation. A third possibility is that thrombopoietin levels and platelet counts are low because of rapid destruction of platelets. Low levels of thrombopoietin have been described in persons with idiopathic thrombocytopenic purpura [15]. The low levels probably result from binding thrombopoietin to platelets and subsequent rapid destruction of platelets (and thrombopoietin) in the spleen. Rapid destruction of platelets is unlikely in patients with cirrhosis because nuclear medicine studies of such patients [1] have demonstrated normal or only slightly decreased platelet survival.

      We did measure thrombopoietin levels in five patients who had cirrhosis and normal platelet counts; as expected, these levels were undetectable. These patients had less severe laboratory abnormalities at baseline (data not shown) and probably had more preserved liver function. This finding supports our hypothesis that as liver function deteriorates, thrombopoietin production and platelet counts decrease.

      In 16 of 17 patients who had orthotopic liver transplantation, thrombopoietin levels increased within 1 week after surgery whereas platelet counts remained stable (Figure 1). These data suggest that changes in platelet counts were not the stimulus for elevated thrombopoietin levels. We hypothesize that thrombopoietin levels increase as a direct result of restored production. The transplanted liver produces normal amounts of thrombopoietin, few platelets are available for binding with thrombopoietin, and plasma levels increase. We would not expect increased levels of thrombopoietin in persons with improved hypersplenism; rather, we would expect platelet counts to increase and thrombopoietin levels to remain unchanged. We did complete serial measurements of thrombopoietin levels in one patient who had cirrhosis and normal platelet counts. As expected, thrombopoietin levels remained undetectable throughout transplantation (data not shown). Overall, we believe that the elevated levels of thrombopoietin seen after liver transplantation are strong evidence that thrombopoietin production is altered in cirrhotic livers and is restored after orthotopic liver transplantation.

      Thrombopoietin levels did vary in patients who had liver transplantation; this may be explained by differences in hypersplenism. Patients with more severe hypersplenism (that is, more platelets sequestered in the spleen) have increased capacity for binding thrombopoietin to platelets. The thrombopoietin produced after liver transplantation binds to sequestered platelets in the spleen, which results in lower levels of thrombopoietin. We could not correlate these lower levels with differences in laboratory tests done before surgery, liver biopsy findings after surgery, immunosuppression regimens, or transfusion requirements.

      Although thrombopoietin mRNA transcript levels were slightly decreased in cirrhotic livers, the biologic significance of this difference is unclear. Other factors are probably involved. The carboxyterminal domain of thrombopoietin is modified substantially after translation. Defective modifications may alter the function or kinetics of thrombopoietin.

      In conclusion, altered production of thrombopoietin seems to contribute to the presence of thrombocytopenia in patients with cirrhosis. Additional studies are required to further define the relation between altered production of thrombopoietin and concurrent hypersplenism in these patients.

      Dr. Somberg: Box 0630, Parnassus Avenue, University of California, San Francisco, Medical Center, San Francisco, CA 94143.

      Drs. Meng and de Savauge: Bioanalytical Technology Department, Genentech, Inc., 460 Point San Bruno Boulevard, South San Francisco, CA 94080.

      Dr. Cohen: Molecular Oncology Department, Genentech, Inc., 460 Point San Bruno Boulevard, Mailstop #37, South San Francisco, CA 94080.

      Mr. Heid: 91 Belleou Avenue, Atherton, CA 94027.

      Dr. Shuman: Box 0128, Parnassus Avenue, University of California, San Francisco, Medical Center, San Francisco, CA 94143.

      References

      1. 1.
      2. 2.
      3. 3.
      4. 4.
      5. 5.
      6. 6.
      7. 7.
      8. 8.
      9. 9.
      10. 10.
      11. 11.
      12. 12.
      13. 13.
      14. 14.
      15. 15.
      « Previous | Next Article »Table of Contents