After the Wilson disease gene was mapped to chromosome 13q14.3, linkage analysis became available for preclinical testing [8]. This DNA-based diagnostic test can be done only in siblings of an index patient whose diagnosis was made according to phenotypic criteria and only if DNA from both parents is available. The detection of more than 50 different mutations in the Wilson disease gene (ATP7B) represents a significant step toward direct genetic diagnosis [9]. Most of these mutations occur in only a few families or patients. In contrast, the His 1069Gln mutation is far more frequent and is present in at least one third of patients of Northern or Eastern European origin who have Wilson disease [9, 10]. This point mutation (CA transversion in exon 14) results in a change from histidine to glutamine at amino acid position 1069. We developed a semi-nested, rapid polymerase chain reaction (PCR) method to detect the His1069Gln mutation and used it to determine the distribution of this mutation in 83 patients with Wilson disease and family members of homozygous patients in Austria. We then correlated the mutation status with clinical findings and liver histologic findings.

Methods

Top Methods Results Discussion Author & Article Info References

Patients

Eighty-three patients with Wilson disease from 72 families were consecutively examined. Sixty-three patients received a diagnosis and were followed at the Department of Gastroenterology and Hepatology, University of Vienna, Austria; 7 were seen at the University Hospital of Innsbruck, Austria; and 3 were seen at the University Hospital of Graz, Austria. For these 73 patients, serial clinical data (including liver histologic findings, quantitative hepatic copper content, and results of electroencephalography and neurologic magnetic resonance studies) were available from the time of diagnosis and were collected over a 15-year period. Data on the remaining 10 patients were supplied by referring physicians. All families of index patients who were homozygous for the His1069Gln mutation were contacted for screening.

Blood samples were collected from all living persons with Wilson disease and their parents, siblings, and more distant relatives (such as grandparents, uncles, and aunts). Wilson disease was diagnosed on the basis of typical symptoms, the presence of Kayser-Fleischer rings seen by slit lamp, and conventional biochemical indicators (low serum concentrations of copper and ceruloplasmin; elevated excretion of urinary copper during a 24-hour period; and, in most cases, increased levels of hepatic copper). Details of the molecular genetic analysis used to diagnose Wilson disease in one asymptomatic sibling have recently been reported [11].

Biochemical Analysis

Serum ceruloplasmin levels (normal level, 200 to 600 mg/L) were measured by using radial immunodiffusion (NOR-Partigen Coeruloplasmin, Behring, Marburg, Germany). Levels of glutamate pyruvate aminotransferase, glutamate oxaloacetate aminotransferase, bilirubin, and -glutamyltranspeptidase were measured by using standard methods. Copper content (normal level < 50 µg/g dry weight) in dried liver tissue was determined by flame atomic-absorption spectroscopy according to the method described by Kingston and Jassie [12].

Liver Histologic Analysis

Liver biopsy specimens were evaluated in a blinded manner by an experienced pathologist using both a conventional descriptive diagnosis (chronic persistent hepatitis, chronic active hepatitis, cirrhosis, steatosis, and fibrosis) and Scheuer's classification system [13]. All biopsy specimens were obtained at diagnosis before the start of treatment.

DNA Analysis

High-molecular-weight DNA was isolated from whole peripheral blood or lysed mononuclear cells according to standard procedures. Using the intronic primers 3348 and 3349 as previously described [14], we did PCR to amplify exon 14 (the location of the His1069Gln mutation) of the Wilson disease gene from samples of 100 to 200 ng of genomic DNA. The reactions were done in a total volume of 50 µL that contained 2 mmol of MgCl₂ per L, 200-µmol concentrations of each deoxynucleoside triphosphate per L, 50 pmol of each primer, and 0.15 U of Dynazyme-DNA Polymerase (Finnzymes, Espoo, Finland).

Thirty-three amplification cycles were performed in a Perkin-Elmer 2400 thermocycler (Foster City, California). Each cycle consisted of denaturation at 94 °C for 20 seconds, annealing at 58 °C for 30 seconds, and extension at 72 °C for 25 seconds. After completion of the first PCR test, the resulting product of 337 base pairs (representing exon 14 of the Wilson disease gene) was used as a template for the second PCR test, in which the mismatch primer MUT 1070 = 5' TGCGCAGGCCAGCAGTGAGC3' (mismatch in italics) and the complementary intronic primer 3348 from the exon amplification were used. In this second test, a restriction site is created in wild-type DNA but not in the mutated chromosome. This difference can be used to detect the mutation by digesting the product of this reaction for 2 hours with the restriction enzyme BsiHKA I under the buffer and temperature conditions recommended by the manufacturer (New England Biolabs, Beverly, Massachusetts). The digested samples were then subjected to electrophoresis through a 9% nondenaturing polyacrylamid gel and stained with ethidium bromide. Fragments of DNA were photographed under ultraviolet transillumination. The mutation could then be detected by demonstration of a different migration velocity on the gel.

The electrophoretic separation of the alleles after digestion of the PCR product allows the determination of the His1069Gln mutation status (Figure 1). Incomplete digestion of the primary PCR product by BsiHKA I was excluded by several control experiments. In each set of PCR reactions, DNA from known homozygotes, heterozygotes (healthy carriers), compound heterozygotes (persons with symptomatic Wilson disease), and healthy controls was amplified and digested simultaneously under identical reaction conditions. The reliability of this method was also tested in a group of 30 healthy controls.

View larger version (73K): [in this window] [in a new window]   Figure 1. Separation of alleles after digestion with the restriction enzyme BsiHKA I. Lane 1. Healthy control. Lane 2. Patient with unknown mutations in both chromosomes. Lane 3. Heterozygous carrier of the His 1069Gln mutation. Lane 4. Compound heterozygous patient with unknown second mutation. Lane 5. Blank. Lane 6. Patient with Wilson disease who was homozygous for the His1069Gln mutation. The fragments from patients who were homozygous for the His1069Gln mutation were uncut and show a single band. Fragments from heterozygotes or compound heterozygotes (who had the His1069Gln mutation and an unknown mutation with phenotypic disease) were partially digested and show two bands. The fragments from healthy persons or patients with other mutations show a single band that is 21 base pairs shorter. M = Msp I marker.

Statistical Analysis

Data on age, symptoms, and liver biopsy findings at presentation were analyzed in the index patients only. An unpaired Student t-test or chi-square test was used to calculate the significance levels of 2 x 2 contingency tables. A P value of 0.05 or less was considered significant. In most cases, 95% CIs are provided for the ratios of proportions of the number of women and neurologic symptoms and for the mean differences of age at symptom onset and age at diagnosis [15]. Data are given as the mean ±SD unless otherwise noted. We used SIGMA STAT Statistical Software, Version 1.0 (Jandel Scientific Corp., San Rafael, California).

Results

Top Methods Results Discussion Author & Article Info References

Twenty index patients (including 5 siblings) were homozygous for the His1069Gln mutation, and 33 (including 4 siblings) were compound heterozygotes. The mutation was not detected in 30 patients (including 2 siblings); these patients were classified as having other mutations. Thus, the His1069Gln mutation was present in 61% of the Austrian patients with Wilson disease in our study. Important differences were seen among the three groups. First, patients who were homozygous for the His1069Gln mutation were older at the time of symptom onset (24 ± 6 years of age) than were compound heterozygotes (17 ± 6 years [CI, 3.3 to 10.7 years]; P = 0.0135) and patients with other mutations (18 ± 8 years [CI, 1.8 to 10.2 years]; P = 0.117) (Figure 2). No homozygote younger than 16 years of age presented with symptoms. Second, sex distribution differed markedly for the three groups; 73.3% of homozygotes were women compared with 48% of heterozygotes (CI, 0.94% to 2.46%) and 50% of patients with other mutations (CI, 0.91% to 2.37%) (P = 0.05). Finally, homozygotes had neurologic symptoms more frequently (73.3%) than did heterozygotes (37.9% [CI, 0.1% to 3.4%]) and patients with other mutations (35.7% [CI, 1.1% to 3.7%]).

View larger version (29K): [in this window] [in a new window]   Figure 2. Correlation of genotype with age at symptom onset.

Liver biopsy findings did not differ significantly among the three groups, but liver disease was less severe in homozygotes. Liver biopsy results were available for 20 homozygotes (7 with cirrhosis, 6 with chronic hepatitis, and 7 with steatosis or fibrosis), 27 heterozygotes (8 with cirrhosis, 12 with chronic hepatitis, and 7 with steatosis or fibrosis), and 23 patients with other mutations (12 with cirrhosis, 5 with chronic hepatitis, and 6 with steatosis or fibrosis). Symptomatic liver disease was diagnosed in 7 homozygotes (46.7%), 18 compound heterozygotes (62%), and 18 patients with other mutations (64.3%). Liver copper content was assayed in 15 homozygotes (770 ± 153 µg/g), 13 heterozygotes (1051 ± 207 µg/g), and 16 patients with other mutations (1119 ± 343 µg/g). The three groups did not differ significantly for symptomatic liver disease or hepatic copper content.

Table 1 shows the clinical characteristics of patients who were homozygous for the His1069Gln mutation. Seven patients presented with liver disease; in two, diagnosis was delayed for many years and was only made when neurologic symptoms occurred. Eight patients presented with neurologic or psychiatric disorders such as tremor, ataxia, dysarthria, and depression. Patient 1 initially presented with liver disease; this patient's condition worsened because of noncompliance, and he developed severe neurologic symptoms. Details of this case were reported previously [16].

Two families had no living relatives, one family was not living in Austria, and one family declined testing. Thus, data are available from 11 families. We used the PCR-based assay to screen 98 asymptomatic family members of 11 index patients who were homozygous for the His1069Gln mutation. Four siblings were identified as homozygous for the mutation, including two in whom the condition was previously diagnosed by linkage analysis [11] (Table 2). Heterozygosity was confirmed by PCR in 30 obligate heterozygotes (19 parents and 11 children) and in 16 distant relatives (second-, third-, and fourth-degree). In the remaining 48 asymptomatic patients, both chromosomes lacked the mutation. Serum ceruloplasmin levels were decreased in only 2 heterozygotes (4.2%). Figure 3 shows the application of the PCR test for the His1069Gln mutation in the family of patient 13.

View larger version (12K): [in this window] [in a new window]   Figure 3. Pedigree of patient 13. Filled squares indicate clinically affected men; filled circles indicate clinically affected women; half-filled symbols indicate heterozygous carriers; and symbols filled with diagonal lines indicate persons not examined. * dead relatives of patient 13; patient 13; sister of patient 13.

Discussion

Top Methods Results Discussion Author & Article Info References

Direct gene analysis is being increasingly used as a diagnostic strategy for many diseases. New methods are needed, however, because all current techniques for gene analysis are time consuming, expensive, or inefficient. We used a rapid, semi-nested PCR test to detect the His1069Gln mutation in persons with Wilson disease and their families. In our study, 61% of Austrian patients with Wilson disease were either homozygous or compound heterozygous for the His1069Gln mutation. Because this mutation was frequently found in the patients in our study, we think that PCR may help detect previously undiagnosed cases of Wilson disease. Polymerase chain reaction has already been useful in family screening: Two homozygous asymptomatic siblings of two patients with Wilson disease (patients 6 and 13) received a diagnosis within 3 days without additional laboratory tests (Figure 3 and Table 2). The absence of this mutation, however, does not rule out a diagnosis of Wilson disease; other genetic tests, such as haplotyping and sequencing, may be necessary. In addition, because the other mutations described in Wilson disease occur only sporadically, detection is not feasible with similar PCR-based tests.

The rate of occurrence of the His1069Gln mutation that we observed (61%) is the highest reported to date. Slightly lower rates were found in German (Ha-Hao D. Personal communication), Polish [17], and Dutch patients [10] and in Canadian patients of European origin [9]. In contrast, the mutation was present in only 13% of non-Sardinian Mediterranean patients [18] and was absent in patients with Wilson disease from Sardinia [18], India (Balac P. Personal communication), and Asia [9]. Therefore, the His1069Gln mutation seems to originate from central or eastern Europe. The high rate of occurrence of this mutation in Austria reflects the mixed population of the former Austro-Hungarian Empire, which arose primarily from the central and eastern Europe [19].

Because we tested a large number of families from similar ethnic backgrounds, we were able to analyze genotype-phenotype relations. Patients who were homozygous for the His1069Gln mutation were older than patients with Wilson disease who had other mutations. They were also more likely to be female (73.3%), had neurologic symptoms more frequently, and had less severe liver disease compared with patients who had other mutations or compound heterozygotes. The long delay in diagnosing Wilson disease in homozygotes further underscores the uncharacteristic initial symptoms in this group of patients. These observations confirm our previous preliminary findings that this mutation may occur in patients with later onset and a neurologic presentation [9, 10]. The function of ATP7B may be incompletely impaired, thereby allowing some excretion of copper into bile.

The unexpected finding of an uneven distribution of the His1069Gln mutation according to sex in homozygotes may indicate that female sex hormones aggravate hepatic copper accumulation. Similar numbers of women with fulminant Wilson disease have also been reported [20-22]. However, these patients were younger than the His1069Gln homozygotes in our study, and no patient with fulminant Wilson disease in our study was homozygous for the His1069Gln mutation. Most patients with fulminant Wilson disease present within a year after menarche; this suggests that female sex hormones trigger the development of progressive liver disease in girls with Wilson disease. Female sex hormones may also aggravate Wilson disease by inducing mild cholestasis. Recent data on the effects of sex hormones on the progression of copper-induced hepatitis in Long-Evans cinnamon rats [23] support this hypothesis.

By using a rapid, semi-nested, PCR-based assay, family members of patients who are homozygous for the His1069Gln mutation can be screened within 48 hours. Until now, family screening could only be done by time-consuming DNA linkage analysis [11]. With PCR, detection of heterozygosity was possible even when first-degree relatives were not available for testing. The mutation was detected in four asymptomatic homozygotes, and the diagnosis of Wilson disease was confirmed by elevated hepatic copper levels (Table 2). Forty-six heterozygous carriers were also found. In the absence of a homozygous index patient, however, the usefulness of PCR is limited. Without independent diagnostic tests, distinguishing compound heterozygotes from heterozygotes is impossible. The limitations and pitfalls of genetic testing by molecular biological methods were recently outlined [24]. Despite these limitations, PCR is useful for presymptomatic diagnosis of this treatable disease and allows quick testing of many samples at a reasonable cost.

Dr. Balac: Department of Paediatrics, University of Sheffield, Sheffield S10 2TH, England, United Kingdom.

Dr. Dienes: Department of Pathology, University of Cologne, Josef-Stelzmann Strasse 9, D-50931 Cologne, Germany.

Dr. Kaserer: Department of Clinical Pathology, University of Vienna, Wahringer Gurtel 18-20, A-1090 Vienna, Austria.

Dr. Datz: 1st Department of Medicine, LKH Salzburg, Mullnerhauptstrasse 48, A-5020 Salzburg, Austria.

Dr. Vogel: Department of Internal Medicine, University of Innsbruck, Anichstrasse 35, A-6020 Innsbruck, Austria.