Annals
Established in 1927 by the American College of Physicians
:
Advanced search
box Article
 arrow  Table of Contents                
space
 arrow  Abstract of this article Free
space
 arrow  Figures/Tables List
space
 arrow  Related articles in Annals
space
 arrow  Articles citing this article
space
box Services
 arrow  Send comment/rapid response letter
space
 arrow  Notify a friend about this article
space
 arrow  Alert me when this article is cited
space
 arrow  Add to Personal Archive
space
 arrow  Download to Citation Manager
space
 arrow  ACP Search                        
space
 arrow  Get Permissions
space
box Google Scholar
 arrow  Search for Related Content
space
box PubMed
Articles in PubMed by Author:
  arrow  Schapiro, J. M.
space
  arrow  Merigan, T. C.
space
 arrow  Related Articles in PubMed
space
 arrow  PubMed Citation
space
 arrow  PubMed
space

ARTICLE

The Effect of High-Dose Saquinavir on Viral Load and CD4+ T-Cell Counts in HIV-Infected Patients

right arrow Jonathan M. Schapiro, MD; Mark A. Winters, MSc; Fran Stewart, PhD; Bradley Efron, PhD; Jane Norris, PAC; Michael J. Kozal, MD; and Thomas C. Merigan, MD

15 June 1996 | Volume 124 Issue 12 | Pages 1039-1050

Objective: To evaluate the efficacy and safety of high-dose therapy with the human immunodeficiency virus (HIV) protease inhibitor saquinavir and to establish the duration of the effect of this therapy.

Design: Open-label study.

Setting: Clinical research referral center.

Patients: 40 adults with human immunodeficiency virus type 1 (HIV-1) infection and CD4+ T-cell counts of 200 to 500 cells/mm3.

Intervention: Monotherapy with 3600 mg or 7200 mg of saquinavir per day, in six divided doses, for 24 weeks.

Measurements: Patients were monitored for adverse events and were evaluated monthly for CD4+ T-cell count, HIV-1 viral load (as measured by reverse transcriptase polymerase chain reaction [PCR] for plasma HIV RNA levels), immune-complex-disassociated p24 antigen levels, peripheral blood mononuclear cell viral DNA levels (as measured by PCR), and resistance mutations to saquinavir. Quantitative peripheral blood mononuclear cell cultures were also done every 2 months.

Results: The low-dose saquinavir regimen (3600 mg/d) resulted in a maximal mean decrease in plasma HIV RNA levels of 1.06 log RNA copies/mL of plasma and a mean maximal increase in CD4 counts of 72 cells/mm3. At week 24, the plasma HIV RNA level remained 0.48 log RNA copies/mL of plasma lower than baseline (P < 0.001) and the CD4 count remained 31 cells/mm3 higher than baseline (P = 0.165). The high-dose saquinavir regimen (7200 mg/d) produced a mean maximal decrease in the plasma HIV RNA level of 1.34 log RNA copies/mL of plasma and a mean maximal increase in CD4 count of 121 cells/mm3. At week 24, the plasma HIV RNA level remained 0.85 log RNA copies/mL of plasma lower than baseline (P < 0.001) and the CD4 count remained 82 cells/mm3 higher than baseline (P = 0.002). The high-dose regimen produced a greater reduction in plasma HIV RNA level (P = 0.08), a greater reduction in peripheral blood mononuclear cell cultures (P = 0.008), and a greater increase in CD4 count (P = 0.002) than did the low-dose regimen. Higher plasma drug concentrations in individual patients correlated with greater reductions in plasma HIV RNA levels over the two doses. Nine patients receiving the low-dose regimen and four patients receiving the high-dose regimen developed key saquinavir resistance mutations. Adverse reactions, most commonly gastrointestinal problems and elevated serum aminotransferase levels, were more common in patients receiving the high-dose regimen, but most adverse events were mild and all were reversible.

Conclusion: Saquinavir is a potent antiviral agent that has a favorable toxicity profile at high doses. Higher doses produce a greater and more durable suppression of viral load and elevation in CD4+ T-cell counts and may delay the development of resistance mutations. Therapy with high-dose saquinavir alone or in combination with other antiretroviral agents should be investigated further.


Human immunodeficiency virus (HIV) protease inhibitors are a new class of antiretroviral agents that target a different point in the HIV life cycle than do zidovudine and other dideoxy nucleoside or non-nucleoside reverse transcriptase inhibitors. The HIV genes gag and gag-pol are translated into large polyproteins that contain the individual structural and functional HIV proteins. The HIV protease is required to cleave these polyproteins to produce infectious virus. Studies showing that the inhibition of the HIV protease resulted in the production of immature and noninfectious virus [1-3] led to the development of HIV protease inhibitors.

Saquinavir is a transitional state analogue peptidomimetic inhibitor of the HIV protease [4, 5]. In vitro studies have shown that it is a potent inhibitor of HIV replication [5, 6]; preliminary clinical trials [7] have shown that it elevates CD4+ T-cell counts and suppresses viral load as measured by plasma HIV RNA levels. Pharmacokinetics studies have shown that it has low bioavailability [8]. Reported side effects are of mild to moderate intensity and include abdominal discomfort, vomiting, diarrhea, headache, and dizziness. Abnormal laboratory results have included occasional elevations in serum aminotransferase and creatinine phosphokinase levels [7].

As have patients receiving other antiretroviral agents, patients receiving protease inhibitors have had mutations in the HIV genome, and in vitro studies have suggested that phenotypic resistance results from these changes [9-13]. Mutations at codons 48 (G->V) and 90 (L->M) of the HIV protease gene appear to develop in the presence of saquinavir and lead to phenotypic resistance to the drug [14-16]. Mutations at other codons, such as codon 54, have also occasionally been implicated in conferring resistance to saquinavir, and increased resistance has been found when more than one mutation is present [15-17]. Resistance mutations to other protease inhibitors currently being studied in clinical trials have also been well documented [18-20]. Cross-resistance between protease inhibitors has been shown to occur in vitro [9, 20, 21]. Although some evidence suggests this may be less of a problem with saquinavir than with other protease inhibitors [9, 22], other reports have shown that saquinavir is also involved in cross-resistance [20, 21]. The clinical relevance of these mutations is not yet completely understood.

Saquinavir has been licensed for use in HIV-infected patients at a dose of 1800 mg/d. Studies of saquinavir at this dose showed that it produced a median reduction of 80% in plasma HIV RNA levels and a median elevation of 50 cells/mm3 in CD4+ T-cell count, although the duration of the effect was short and values had returned nearly to baseline by week 16 [7]. Preliminary results comparing combination therapy with zidovudine plus zalcitabine, zidovudine plus saquinavir, and all three drugs together showed that the triple combination produced a more favorable response without increased toxicity [23].

Because saquinavir at a dose of 1800 mg/d had been shown to favorably influence viral load and CD4+ T-cell counts without producing severe toxicity, and because the drug has low bioavailability, it was postulated that higher doses might produce a greater antiviral effect without significantly increasing toxicity. We studied saquinavir at twice and four times the currently licensed dose to determine the efficacy, safety, and pharmacokinetics of saquinavir and to identify the optimal dose of saquinavir for future study both as monotherapy and in combination with other antiretroviral agents.


Methods
space
up arrowTop
dotMethods
down arrowResults
down arrowDiscussion
down arrowAuthor & Article Info
down arrowReferences

Persons who were positive for HIV type 1, were 18 years of age or older, had CD4+ T-cell counts of 200 to 500 cells/mm3, and had no active opportunistic infections were eligible for the study. Saquinavir was dispensed to patients as 200-mg capsules twice weekly and then once monthly. Compliance was monitored by patient report and capsule count.

Toxicity

Patients were initially monitored three times a week, then twice a week, and then once a month for any reported symptoms or signs of drug toxicity. Frequent laboratory testing was also done; tests included measurement of complete blood and platelet counts; serum chemistry tests; liver function tests; tests for amylase, triglyceride, and creatinine phosphokinase levels; and urinalysis. In patients with grade 3 toxicity, drug therapy was briefly discontinued and then restarted.

Virology

Quantitative peripheral blood mononuclear cell cultures were done by incubating serial fivefold dilutions of patient peripheral blood mononuclear cells (starting with 1 x 106 cells) in duplicate with 1 x 106 phytohemagglutin-stimulated normal peripheral blood mononuclear cells for 14 days. This was done according to the AIDS (acquired immunodeficiency syndrome) Clinical Trials Group consensus protocol for quantitative microcultures [24]. Measurements of p24 antigen levels were made for each dilution by using a commercially available p24 antigen kit (Abbott Diagnostics, Chicago, Illinois), and the results were expressed as infectious units per million peripheral blood mononuclear cells.

Plasma HIV RNA levels were measured by using a previously described reverse transcriptase polymerase chain reaction (PCR) technique [25] that has been validated in a multicenter study [26]. Duplicate plasma samples were subjected to ultracentrifugation, and the pellets were extracted by using phenolchloroform. The resulting RNA pellets were reverse transcribed along with a standard curve of known RNA copy number and then amplified by PCR with gag-specific primers. The amount of product in each reaction was measured using a nonisotopic enzyme hybridization assay and was expressed as optical density. The standard curve was generated by plotting the number of RNA copies against the optical density, and the Equation describing the curve was used to calculate the numbers of RNA copies in the patient samples. These numbers were expressed as log RNA copies/mL of plasma.

Serum p24 antigen levels were measured by Immunodiagnostic Laboratories (Hayward, California) using an enzyme-linked immunoassay system with an immune-complex disassociation step.

Peripheral blood mononuclear cell viral DNA levels were measured using a previously described quantitative PCR technique [27]. Aliquots of 1 x 10 (6) peripheral blood mononuclear cell pellets were lysed with proteinase K, and 250 000 cell equivalents were amplified in duplicate with a standard curve of known DNA copy number. The amount of product in each reaction was measured using a nonisotopic enzyme hybridization assay and expressed as optical density. The standard curve was generated by plotting the number of DNA copies against optical density, and the Equation describingthe curve was used to calculate the number of DNA copies in the patient samples. These numbers were corrected for percentages of cells that are CD4 cells and expressed as log DNA copies per million CD4 cells.

Immunology

CD4+ T-cell counts were measured by the AIDS Clinical Trials Group-qualified flow cytometry laboratory at Stanford University Hospital. A screening measurement and two baseline measurements (obtained 2 weeks apart) were done. The average of these three results was used as the baseline value. CD4+ T-cell counts were obtained monthly at the same time that blood was drawn for virologic tests.

Mutations

The presence of mutations at codon 48 (G->V) and 90 (L->M) in the plasma of patients was determined by using a selective PCR method similar to that used for the reverse transcriptase gene [28, 29]. Cryopreserved plasma was extracted as previously described [25] and was reverse transcribed using primer TGGAGTATTGTATGGATTTTCAG (Pro1). The complementary DNA was then amplified by using PCR under standard conditions with primer CAGAGCCAACAGCCCCACCA (Pro2). Five µL of the 582-base pair first-round PCR product was then amplified with primers specific for the wild-type and mutant sequences at each codon. For codon 48, primers CTTCCTTTTCCATCTCTGTA (IR48) and TGGAAACCAAAAATGACAGG (48WT) were used to determine whether a wild-type sequence was present, and IR48 and TGGAAACCAAAAATGACAGT (48MU) were used to determine whether a mutant sequence was present. For codon 90, primers GAAGCTCTATTAGATACAGG (IR90) and GTGCAACCAATCTGAGCCAA (90WT) were used to determine whether a wild-type sequence was present, and IR90 and GTGCAACCAATCTGAGCCAT (90MU) were used to determine whether a mutant sequence was present. Twenty µL of the PCR product from each of the second set of PCR reactions was analyzed for genotype on 3.0% agarose gel with ethidium bromide staining. The PCR products were determined to have a mutant or wild-type sequence according to the method described by Boucher and colleagues [30, 31] and Larder and associates [28]. A sample was considered to contain the codon 48 wild-type sequence if amplification with primers IR48 and 48WT resulted in a 309-base pair product. A sample was considered to contain the codon 90 wild-type sequence if amplification with primers IR90 and 90WT resulted in a 228-base pair product. A sample was considered to contain the codon 90 mutant sequence if amplification with primers IR90 and 90MU resulted in a 228-base pair product. Samples showing bands in both the wild-type and mutant reactions were re-evaluated using 5 µL of a 1:20 and 1:400 dilution of the first-round PCR product in a second-round reaction. Samples showing only a wild-type or mutant product in the dilution reactions were scored as wild-type or mutant, respectively. Samples showing both the wild-type and mutant products in the dilution reactions were considered to be mixtures. Samples in which a mixture was detected were reported as mutant for the purposes of the analysis. Patients showing a mutation at either codon 48 or codon 90 at week 24 were assayed at earlier time points to determine the timing of the appearance of the mutation.

The selective PCR assays were validated by complete sequencing of the protease gene on a subset of 38 samples by using standard dye-terminator sequencing. The first-round PCR product used in the selective PCR assay was used to generate a second PCR fragment using primers for -PRO4 (TGTAAAACGACGGCCAGTAGCCCCACCAGAAGAGAGCTT), which contained the M13(– 20) primer sequence, and primer IR. This product was sequenced by using the M13 forward primer and dye-labeled dideoxy terminators with an Applied Biosystems Model 370A (Foster City, California). All sequences were proofread manually.

Pharmacokinetics

Samples of venous blood (5 mL each) were collected into plastic tubes (heparin was used as an anticoagulant agent) from the first eight patients in each treatment group. Samples for pharmacokinetics analysis were taken as follows. On day 1 and day 112 (week 16), samples were taken before and 1, 2, 4, 5, 6, 8, 9, 10, and 12 hours after the first morning dose. On day 28, they were taken before and 1, 2, 4, 5, 6, 8, 9, 10, 12, 13, 14, 16, 17, 18, 20, 21, 22, and 24 hours after the first morning dose. Patients were given food before all doses were given.

The samples were kept on ice until the plasma was separated by centrifugation (which was done within 30 minutes of collection) and stored at – 20 °C. Before shipment, all samples were inactivated by heat treatment in a waterbath at 56 ± 1 °C. Samples were stored at – 20 °C before shipment. Total plasma concentrations were measured by radioimmunoassay using a method under the control of the pharmacokinetics and metabolism department at Roche Products Ltd. (Welwyn, United Kingdom). Individual pharmacokinetics variables were derived by "noncompartmental" methods. Maximum plasma concentration, time to maximum concentration, minimum plasma concentration, and time of minimum plasma concentration were observed variables. The area under the concentration versus the time curve was calculated (Topfit 2.0; Gustav, Fischer, and Verlag; New York, New York) by the trapezoidal method, assuming linear changes between points. The average concentration was calculated by dividing the area under the concentration curve by the period over which it was calculated. Accumulation was assessed by dividing the area under the concentration curve for the last dose on day 1 by the corresponding area under the concentration curve from the first dose on day 1.

Statistical Analysis

Statistical analysis was done by Bradley Efron. Analyses were done using one- or two-sample Wilcoxon tests, always two-sided, on log differences.


Results
space
up arrowTop
up arrowMethods
dotResults
down arrowDiscussion
down arrowAuthor & Article Info
down arrowReferences

Forty volunteers who were positive for HIV-1 and had CD4+ T-cell counts of 200 to 500 cells/mm3 were enrolled. Twenty received 600 mg of saquinavir (Roche Products, Welwyn, United Kingdom) six times daily for a total daily dose of 3600 mg, and 20 received 1200 mg of saquinavir six times daily for a total daily dose of 7200 mg. The study included 39 men and 1 woman who were 25 to 55 years of age (mean age, 39.7 years) and had an average CD4+ T-cell count of 346 cells/mm3 (range, 188 to 527 cells/mm3). The age distribution did not differ significantly between the treatment groups. The average CD4+ T-cell count in the low-dose group was 349 ± 86 cells/mm3 (range, 188 to 498 cells/mm3). This was not significantly different from the average CD4+ T-cell count in the high-dose group, which was 342 ± 95 cells/mm3 (range, 212 to 527 cells/mm3). Results of tests for p24 antigen were positive in 11 patients in the low-dose group and 3 patients in the high-dose group at study enrollment. The mean plasma RNA level at baseline was higher for the low-dose patients (4.86 ± 0.72 log RNA copies/mL of plasma [range, 3.21 to 5.87 log RNA copies/mL of plasma]) than for the high-dose patients (4.39 ± 0.79 log RNA copies/mL of plasma [range, 2.79 to 5.6 log RNA copies/mL of plasma]) (P = 0.053). Sixteen patients in each group had not had substantial previous antiretroviral therapy (< 3 months). Four patients in each group had had previous zidovudine therapy and had evidence of mutation at codon 215 of the reverse transcriptase gene, which is known to confer resistance to zidovudine. Three patients receiving the high-dose saquinavir regimen did not complete the study. One discontinued therapy during the first week; this patient reported lightheadedness, which resolved when he stopped taking saquinavir, but he refused any further follow-up. Thus, his data were not included. Patients receiving the high-dose regimen were required to take 36 pills each day, and 2 patients stopped receiving therapy prematurely because of poor compliance, one after 12 weeks and one after 16 weeks. Neither had evidence of toxicity. Their data up to the time that they dropped out of the study were included.

CD4+ T-cell Counts

The low-dose group had an initial increase in mean CD4+ T-cell count of 72 cells/mm3 (95% CI, 22.4 to 139.2 cells/mm3). The count peaked at week 4 and thereafter gradually decreased toward the baseline value: The mean CD4+ T-cell count at week 24 was 31 cells/mm3 (CI, minus9.1 to 70.5 cells/mm3) higher than the value at baseline (Figure 1). The mean elevation from baseline value was found to be statistically significant for weeks 2 through 16 (P < 0.04 for all comparisons). The mean elevation from baseline values at weeks 20 and 24 was not statistically significant (P > 0.19). Seventeen patients in this low-dose group had an initial increase in CD4+ T-cell count of at least 50 cells/mm3. The mean CD4+ T-cell count in the high-dose group increased to a peak of 121 cells/mm3 (CI, 68.1 to 166.9 cells/mm3) higher than the baseline value at week 20 and remained 82 cells/mm3 (CI, 26.3 to 113.5 cells/mm3) higher than the baseline value at week 24. The mean elevation from baseline values in this group was found to be statistically significant for weeks 2 through 24 (P < 0.02 for all comparisons). All patients in the high-dose group had an increase in CD4 count of at least 50 cells/mm3. The mean elevation in CD4 count from baseline values was significantly greater in the high-dose group than in the low-dose group at weeks 12 (P = 0.03) and 20 (P = 0.002). The difference between the groups did not reach statistical significance at the other time points.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 1. CD4+ T-cell counts and plasma human immunodeficiency virus (HIV) RNA levels over time in patients receiving saquinavir, 3600 mg/d or 7200 mg/d. Top. Patients receiving 3600 mg/d. Open squares = CD4+ T-cell counts; open circles = plasma HIV-1 RNA levels. Bottom. Patients receiving 7200 mg/d. Solid squares = CD4+ T-cell counts; solid circles = plasma HIV-1 RNA levels. Bars indicate 95% Cls.

 
Viral Load as Measured by Reverse Transcriptase Polymerase Chain Reaction for Plasma HIV RNA Levels

The mean plasma HIV RNA level decreased from 4.86 to 3.82 log RNA copies/mL of plasma in the low-dose group (a reduction of 1.06 log RNA copies/mL of plasma [CI, 0.76 to 1.25 log RNA copies/mL of plasma]) and from 4.39 to 3.05 log RNA copies/mL of plasma in the high-dose group (a reduction of 1.34 log RNA copies/mL of plasma [CI, 1.01 to 1.58 log RNA copies/mL of plasma]) (Figure 1). In the low-dose group, the mean plasma HIV RNA level showed a maximal decrease at week 2 and then gradually increased toward the pretreatment value, remaining 0.48 log RNA copies/mL of plasma (CI, 0.21 to 0.64 log RNA copies/mL of plasma) less than the baseline value at week 24. In the high-dose group, plasma HIV RNA levels declined to a nadir at week 4 and then gradually increased toward baseline values, remaining 0.85 log RNA copies/mL of plasma (CI, 0.37 to 1.10 log RNA copies/mL of plasma) less than the baseline value at week 24. The decrease in the mean plasma HIV RNA level to less than baseline was statistically significant for both groups throughout the entire study (P < 0.001), as was the difference in the magnitude of the decrease between the two groups (P < 0.02 for all comparisons except that at week 20; P = 0.08 for the comparison at week 20) at all time points. Fourteen patients receiving the low-dose regimen and 16 patients receiving the high-dose regimen had a maximal decrease of at least one log. At week 24, one patient in the low-dose group and 6 patients in the high-dose group had a sustained decrease of at least one log. This difference between the groups was statistically significant (P = 0.03 using the chi-square for a 2 x 2 table).

Additional Viral Load Markers

Eleven patients in the low-dose group and three patients in the high-dose group were positive for immune-complex-disassociated p24 antigen at baseline. Both groups showed a reduction in immune-complex-disassociated p24 antigen levels that lasted throughout the study (Figure 2). The maximal mean decrease, a decrease to 20% (CI, 4% to 88%) of the baseline value in the low-dose group and to 10% (insufficient sample for calculation of CIs) of the baseline value in the high-dose group, occurred at week 12. These maximal mean decreases from baseline reached borderline statistical significance (P = 0.06 for the low dose; P = 0.06 for the high dose). No statistically significant difference was seen in the reduction in immune-complex-disassociated p24 antigen levels between the high-dose and low-dose groups. Twenty patients in the low-dose group and 19 patients in the high-dose group had positive quantitative peripheral blood mononuclear cell dilution cultures at baseline and therefore could be monitored throughout the study. Culture titers decreased by a mean of 1.2 log DNA copies per million CD4 cells (CI, 0.42 to 1.73 log DNA copies per million CD4 cells) in the low-dose group and a mean of 1.6 log DNA copies per million CD4 cells (CI, 1.06 to 2.10 log DNA copies per million CD4 cells) in the high-dose group, with a nadir at week 8. Titers increased slightly thereafter but remained suppressed through week 24. The mean decrease in the high-dose group was significantly greater than that in the low-dose group at all time points (P < 0.03). Polymerase chain reaction for peripheral blood mononuclear cell viral DNA levels showed a slight reduction in both groups throughout the study. The mean maximal decrease occurred at week 16 and was 0.25 log DNA copies per million CD4+ T cells (CI, 0.10 to 0.39 log DNA copies per million CD4+ T cells) for the low-dose group and 0.41 log DNA copies per million CD4+ T cells (CI, 0.27 to 0.54 log DNA copies per million CD4+ T cells) for the high-dose group. The mean decrease from baseline was not statistically significantly different between the groups (P > 0.05 except at week 16; P = 0.03 at week 16).



View larger version (16K):
[in this window]
[in a new window]
 
Figure 2. Immune-complex-dissociated p24 antigen levels, quantitative peripheral blood mononuclear cell culture titers, and proviral DNA levels over time in patients receiving saquinavir, 3600 mg/d or 7200 mg/d. Top. Immune-complex–dissociated p24 antigen levels. Open circles = patients receiving 3600 mg/d; solid circles = patients receiving 7200 mg/d. Middle. Quantitative peripheral blood mononuclear cell culture titers. Open triangles = patients receiving 3600 mg/d; solid triangles = patients receiving 7200 mg/d. Bottom. Proviral DNA levels. Open squares = patients receiving 3600 mg/d; solid squares = patients receiving 7200 mg/d. IUPM = infectious units per million peripheral blood mononuclear cells.

 

The virologic response of the patients with the codon 215 mutation in their HIV-1 reverse transcriptase gene at baseline did not differ from that of the patients with the wild genotype.

Pharmacokinetics

The number of hemolyzed or clotted samples made it impossible to calculate pharmacokinetics data for one patient on day 1 and one patient on day 112 (both patients were in the high-dose group). In addition, data from one patient at day 112 had not been analyzed at the time of pharmacokinetics assessment. Summary statistics were calculated excluding the data obtained from these patients on the specified days. The mean values of the pharmacokinetics variables are shown in Table 1. Because of the short dose interval and the long absorption period of saquinavir, it was not possible to discern classic pharmacokinetics profiles for separate dose intervals, and pharmacokinetics variables were calculated over 12 or 24 hours as appropriate. The number of patients in whom pharmacokinetics data were obtained was too small to allow for statistical comparisons between groups.


View this table:
[in this window]
[in a new window]
 
Table 1. Mean Pharmacokinetics Variables for Saquinavir after Oral Dosing at 600 mg and 1200 mg Every 4 Hours (Total Daily Doses, 3600 and 7200 mg/d).

 

In both groups, plasma concentrations increased rapidly on day 1, and maximum concentrations were reached at 12 hours. By 12 hours, concentrations had increased 4.5-fold in the low-dose group and 3-fold in the high-dose group. The mean plasma concentration on both day 28 Figure 3 and day 112 increased toward the end of the sampling period. For both the low-dose and high-dose groups, the mean values for the area under the curve to 24 hours on day 28 were twice the areas under the curve calculated over the first 12 hours on day 112 (Table 1). Plasma concentrations over the first 12 hours on days 28 and 112 were similar in the two groups, as were the mean concentrations on days 28 and 112 (Table 1). The maximum concentrations were higher on day 28 because higher concentrations were seen toward the end of the 24-hour period in this group. Mean plasma concentrations for the high-dose group were more than twice those seen for the low-dose group on all sampling days. The mean value for the area under the curve to 24 hours on day 28 was approximately four times higher for the high-dose group (9742 ng · h per mL [48%]) than for the low-dose group (2233 ng · h per mL [35%]). The maximum concentrations achieved on the sampling days were between four and seven times higher for the high-dose group than for the low-dose group.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 3. Mean plasma drug concentrations on day 28 after oral administration of saquinavir, 600 or 1200 mg, every 4 hours (total daily dose, 3600 or 7200 mg). Bars indicate 95% Cls.

 

Drug concentrations were correlated with decrease in viral load for patients who had pharmacokinetics studies (Figure 4). For each patient, the area under the curve at week 4 was plotted against the decrease in plasma HIV RNA level from baseline at week 4. A strong direct correlation was found between drug concentrations and the decrease in viral load from baseline. This was found for both treatment groups and for the data from both groups combined.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 4. Drug levels at week 4 (area under the curve to 24 hours) plotted against the decrease in plasma human immunodeficiency virus (HIV) RNA levels at week 4 for each patient in whom pharmacokinetics were studied. The line represents best fit and was determined using the least-squares algorithm, r = 0.801, expressed as the Pearson correlation coefficient. Open circles = patients receiving 3600 mg of saquinavir per day; solid circles = patients receiving 7200 mg of saquinavir per day.

 

Mutations

Mutations at codons 48 and 90 of the HIV protease gene were determined in plasma samples from each patient by using the selective PCR technique at baseline and at week 24 (Table 2). Samples that showed mutations at week 24 were re-tested at earlier time points to determine the time at which the mutation had first appeared. All patients in both treatment groups had wild-type sequences at both codon 48 and codon 90 at baseline. In the low-dose group, two patients had developed mutations at codon 48 and seven had developed mutations at codon 90 by week 24. In the high-dose group, two patients had developed mutations at codon 48 and two had developed mutations at codon 90. No patients developed both mutations. Altogether, nine patients in the low-dose group and four patients in the high-dose group had developed one of the mutations by the end of the study. This difference did not reach statistical significance (P = 0.09 for the chi-square test). The more sustained suppression of viral load seen in the high-dose group appears to have been accompanied by a lower mutational rate, whereas the weaker suppression of viral load seen in the low-dose group appears to have been accompanied by a higher mutational rate (Figure 5).


View this table:
[in this window]
[in a new window]
 
Table 2. Appearance of Resistance Mutations at Codons 48 or 90 of the Human Immunodeficiency Virus Type 1 Protease Gene at Baseline and Week 24 in Plasma from Patients Receiving Saquinavir, 3600 mg/d or 7200 mg/d

 


View larger version (16K):
[in this window]
[in a new window]
 
Figure 5. Mutations at codons 48 or 90 of the protease gene over time in plasma samples from patients receiving saquinavir, 3600 mg/d or 7200 mg/d. Open circles = plasma human immunodeficiency virus (HIV) RNA levels of patients receiving 3600 mg/d; solid circles = plasma HIV RNA levels of patients receiving 7200 mg/d; {square}s = percentage of patients receiving 3600 mg/d who had mutations; solid squares = percentage of patients receiving 7200 mg/d who had mutations. Bars indicate 95% Cls.

 

Complete Applied Biosystems sequencing of the entire protease gene was done on a subset of 38 samples. A comparison of the results of the Applied Biosystems sequencing and of the PCR assay in the 38 samples tested by both assays showed that there was a 94% correlation between the techniques in the identification of wild-type or mutant genotype at codons 48 and 90. The only discrepancies appeared with the PCR assay showing greater sensitivity in the early detection of mutations as had been seen in our other investigations. Of the 19 samples at week 24 on which complete sequencing of the entire protease gene was done, 1 had acquired the codon 54 mutation (I->V). This patient had also acquired the codon 48 mutation. None of these samples showed the mutations at codons 82 (V->T) or 84 (I->V).

Toxicity

Three patients in the high-dose group and one in the low-dose group required drug "holidays" of 4 to 14 days because of adverse reactions. One had nausea and diarrhea, one was a hepatitis B surface antigen-positive patient and had elevated serum aminotransferase levels, one had increased neutropenia after having a baseline absolute neutrophil count of 1050 cells/mm3, and one had elevated serum creatinine phosphokinase levels (as high as 18 514 U/L) after initiation of a strenuous physical exercise program (Table 3). All toxicities resolved when therapy was discontinued. Therapy was restarted at the full high dose, and the creatinine phosphokinase toxicity did not recur. The elevated serum aminotransferase level recurred after 4 months and required an additional 1-week drug holiday, after which the patient received the full dose for an additional 4 months and had aminotransferase levels in the high end of the normal range. The absolute neutrophil count of the patient with neutropenia returned to the baseline value after the drug holiday, and the patient required a second holiday after 10 weeks. Seven patients in the low-dose group and four in the high-dose group reported mild confusion or lightheadedness that resolved within 1 to 2 weeks in all but one patient.


View this table:
[in this window]
[in a new window]
 
Table 3. Percentage of Patients with Adverse Events in the Groups Receiving Saquinavir, 3600 mg/d or 7200 mg/d

 

Physical examination showed no objective findings in these patients, and a side effect interfered with normal function in only 1 patient. Eleven patients in the low-dose group and 14 patients in the high-dose group had gastrointestinal toxicity, which predominantly presented as diarrhea with occasional abdominal pain and nausea. In 2 patients in the low-dose group and 4 patients in the high-dose group, the toxicities were characterized as moderate; in the other patients, the toxicities were considered mild. Most gastrointestinal toxicities occurred in the first 1 to 2 weeks of therapy and decreased or disappeared thereafter without dose modification.

Drug Continuation Phase after the Study

Patients who showed 1) a sustained increase in CD4+ T-cell counts of 50 cells/mm3 or more or 2) a sustained suppression of plasma HIV RNA level of at least 0.5 log RNA copies/mL of plasma less than baseline, or both, throughout the entire study were allowed to continue receiving saquinavir at the designated dosage after the study had ended. After completing the study, 10 of 20 patients in the low-dose group and 15 of 17 patients in the high-dose group fulfilled these criteria and chose to continue receiving study medication through week 48. At week 32, 9 patients in the low-dose group (45% of the original group) still fulfilled the criteria for sustained response. Two patients in the high-dose group have not yet reached week 32. Of the 15 who have, 12 (75%) still fulfill the criteria for sustained response.


Discussion
space
up arrowTop
up arrowMethods
up arrowResults
dotDiscussion
down arrowAuthor & Article Info
down arrowReferences

We examined the efficacy, safety, and pharmacokinetics of saquinavir therapy at twice and fourfold the dose currently licensed for use (1800 mg/d). Both of the doses we studied increased CD4+ T-cell counts and reduced plasma HIV RNA levels for the 24 weeks of our study. Additional virologic markers, including peripheral blood mononuclear cell cultures, immune-complex-disassociated p24 antigen levels, and peripheral blood mononuclear cell viral DNA levels were all reduced as a result of therapy. The increase in CD4+ T-cell counts and the reduction in plasma HIV RNA levels was greater and lasted longer with the high dose (7200 mg/d) than with the low dose (3600 mg/d). The additional virologic markers also showed a greater reduction with the higher dose. Because both doses continued to decrease these markers at 24 weeks, no difference between the doses in the duration of effect could be determined. A longer observation period may be needed to show that the high-dose regimen has a more durable effect on these virologic markers. When comparing our results with those of a published clinical trial that studied saquinavir monotherapy at doses as high as 1800 mg/d [7], caution must be used, because the two studies differed in baseline patient characteristics, virologic assay techniques, and data analysis, all of which can greatly affect study results. However, even with these limitations, there still appears to be a larger and longer improvement in both plasma HIV RNA levels and CD4+ T-cell counts with higher doses of saquinavir. The dose of 1800 mg/d resulted in a maximal median reduction in plasma HIV RNA levels of about 0.7 log RNA copies/mL of plasma (a reduction of 80%). The low dose (3600 mg/d) in our study resulted in a maximal mean reduction of 1.06 log RNA copies/mL of plasma, and the high dose (7200 mg/d) resulted in a maximal mean reduction of 1.34 log RNA copies/mL of plasma. The duration of viral suppression also seemed to increase with higher doses: Plasma HIV RNA levels had returned to baseline by week 16 with the 1800-mg dose but continued to be 0.48 and 0.85 log RNA copies/mL of plasma less than baseline values at week 24 with the 3600-mg and 7200-mg doses, respectively. Similarly, the maximal increase in the median CD4+ T-cell count was 50 cells/mm3 in the study of the 1800-mg dose, and, in our study, the mean maximal increase was 72 cells/mm3 with the 3600-mg dose and 121 cells/mm3 with the 7200-mg dose. Here, too, the duration of the effect on CD4+ T-cell counts was greater with the higher doses. Of note, in the study of the 1800-mg dose, doses of 75 to 600 mg/d were also studied, and the results showed an increasing effect with increasing doses of saquinavir between 75 and 1800 mg/d. Our findings are also consistent with those of two recently published studies that showed that another HIV protease inhibitor, ritonavir, had a greater and more durable effect with increasing doses [32, 33]. The toxicity profile seen with high doses of saquinavir was favorable compared with those of the dideoxy nucleotide reverse transcriptase inhibitors licensed to date [34-36]. Although the severity and frequency of adverse effects were greater in the high-dose group than in the low-dose group, most patients in the high-dose group had minimal or no toxicity and could complete the study without dose modification. The few major adverse reactions seemed to develop when high doses were administered in the presence of an additional contributing host factor. For example, neutropenia developed in a patient with a suppressed absolute neutrophil count at baseline, and an elevated serum creatinine phosphokinase level appeared in a patient after the patient had started a new, strenuous physical exercise program. It is important to note that all such adverse events were reversible and rapidly cleared with brief discontinuation of therapy.

Clinical studies that used lower doses of saquinavir also reported similar clinical side effects and elevations in serum aminotransferase and creatinine phosphokinase levels. Most toxicities were graded as mild or moderate, and almost none were severe [7]. When used as a component of combination therapy at a dose of 1800 mg/d, saquinavir also had a favorable toxicity profile; the combination of zidovudine, zalcitabine, and saquinavir had no more toxicity than the combination of zidovudine and zalcitabine alone [23].

Our pharmacokinetics results show that saquinavir has modest accumulation, with median increases of 4.5-fold for the low-dose regimen and 3.0-fold for the high-dose regimen. These are slightly greater than the increases seen in earlier studies, but this may be because of the small amount of data available in our study. Once steady state was reached, no change was evident in the pharmacokinetics of saquinavir over the 16-week period; the concentration-time profiles and the average concentration values were similar for both day 28 and day 112. The increase in plasma concentrations of saquinavir over the sampling interval on days 24 and 112 may have been caused by the hospitalization of the patients over the sampling period, which improved compliance. This, however, makes the detection of any circadian effect impossible. The increase in exposure (as represented by the values for the area under the concentration curve to 24 hours) between the two treatment groups is greater than would have been expected from the increase in dose. This is probably caused by the saturation of the enzymes responsible for the metabolism of saquinavir during the absorption process. Saquinavir is rapidly metabolized and undergoes extensive first-pass metabolism, some of which may take place in the gut wall as well as in the liver. Saturation of metabolism in the gut wall or the liver could occur at the very high concentrations seen during absorption. The greater effect of the higher dose on surrogate markers is supported by the finding that higher area-under-the-curve values correlated with a greater decrease in plasma HIV RNA level (Figure 4).

Nine patients receiving the low-dose regimen and four patients receiving the high-dose regimen developed key resistance mutations to saquinavir by week 24. Mutations also tended to appear later in the high-dose group than in the low-dose group. Although the difference between the mutation rates did not reach statistical significance, possibly because of the small numbers, the larger and longer suppression of viral load induced by the higher dose may delay the appearance of resistance mutations. This has also been suggested by others [32] as a possible mechanism for the increased efficacy of higher doses of ritonavir. This suggests that HIV protease inhibitors are unique and contrasts with observations reported in patients who were receiving dideoxy nucleoside reverse transcriptase inhibitors that had less effect on viral load, such as zidovudine and didanosine. In these patients, higher doses actually appeared to result in higher rates of mutation detection [37-39]. Certain combinations of nucleosides capable of producing a suppression of viral load similar to that seen in our high-dose group have delayed the detection rate of specific resistance mutations [40, 41]. However, the exact mechanism of the relation between higher protease inhibitor doses, increased plasma viral suppression, and the apparent low mutation detection rate is unclear. The reduction in viral load, viral turnover, or both may decrease the opportunity for mutations to develop, or the high dose may affect the growth of the resistant mutant forms. We cannot rule out that other factors in our study, such as the lower baseline plasma HIV RNA level in the high-dose group, may have contributed to the apparent delay in the development of mutations.

Cross-resistance between protease inhibitors has been a concern, potentially limiting the use of other agents after patients have been treated with one drug of this class [9, 20-22]. Although some studies have found that resistance mutations to saquinavir largely do not overlap with resistance mutations to other protease inhibitors [22], other reports have found that cross-resistance to saquinavir emerges after patients receive therapy with other drugs [20]. The clinical relevance of these observations has yet to be determined. In our study, the small subset of samples studied by complete genotypic sequencing did not show the mutations at codons 82 (V->T) or 84 (I->V), which have been reported to emerge in vivo and produce cross-resistance to multiple protease inhibitors [20].

Our study has several limitations. Investigators and patients were not blinded to dose assignment, and no placebo group was included. Like many other early-phase studies on new antiretroviral agents, our study provides data not on truly clinical end points, such as mortality, but on surrogate markers, such as CD4+ T-cell count and plasma HIV RNA levels. Although these markers have been shown to correlate with disease progression and are commonly used to determine drug efficacy, these limitations must be kept in mind when our results are extrapolated to clinical practice.

Our results suggest that doses of saquinavir greater than that currently licensed may produce a larger and longer antiviral effect. Even at these higher doses, the toxicity profile of saquinavir appears to be acceptable. The development of resistance mutations may be delayed as a result of higher doses and a more profound and durable suppression of viral load. Preliminary data have shown that the addition of saquinavir at the licensed dose to combination therapy increases the efficacy of reverse transcriptase inhibitors without increasing toxicity. We believe that our results warrant further study of higher doses of saquinavir as monotherapy and, in particular, in combination with other antiretroviral agents. A new formulation of saquinavir with improved bioavailability that is currently being tested could result in higher exposures to the compound, which could lead to a reduction in the cost and number of pills taken daily.

Mr. Winters: Division of Infectious Diseases, Room S-146, 300 Pasteur Drive, Stanford University School of Medicine, Stanford, CA 94305.

Dr. Stewart: Roche Products Ltd., PO Box 8, Broadwater Road, Welwyn Garden City, Herts AL7 3AY, United Kingdom.

Dr. Efron: Health, Research, and Policy, Sequoia Hall, Room 106, Stanford University, Stanford, CA 94305-4065.

Ms. Norris: Center for AIDS Research, Room S-168, 300 Pasteur Drive, Stanford University School of Medicine, Stanford, CA 94305-5107.

Dr. Kozak Division of Infectious Diseases, 200 Hawkins Drive, The University of Iowa College of Medicine, Iowa City, IA 52242-1081.

Dr. Merigan: Center For AIDS Research, S-156 Grant Building, Stanford University, Stanford, CA 94305.


Author and Article Information
space
up arrowTop
up arrowMethods
up arrowResults
up arrowDiscussion
dotAuthor & Article Info
down arrowReferences

For author affiliations and current author addresses, see end of text.
Acknowledgments: The authors thank Drs. Cheryl Karol, Richard Ginsberg, and Miklos Salgo (Roche Pharmaceuticals, Inc., Nutley, New Jersey) for their support, Patricia Cain for clinical assistance, and Shannon Crawford, Kathy Richmond, and Teri Banks for technical assistance.
Grant Support: By Hoffmann-LaRoche and grant GCRC RR00070 from the National Institutes of Health. Roche Products had no influence on the gathering of the data, the interpretation of the data, or the reporting of the results, which were all the responsibility of the primary investigator, Dr. Merigan. Dr. Merigan has no financial interest in saquinavir or in Roche Products.
Requests for Reprints: Thomas C. Merigan, MD, Center For AIDS Research, S-156 Grant Building, Stanford University, Stanford, CA 94305.
Current Author Addresses: Dr. Schapiro: Division of Infectious Diseases, Room S-156, 300 Pasteur Drive, Stanford University School of Medicine, Stanford, CA 94305-5107.


References
space
up arrowTop
up arrowMethods
up arrowResults
up arrowDiscussion
up arrowAuthor & Article Info
dotReferences

1. Meek TD, Lambert DM, Dreyer GB, Carr TJ, Tomaszek TA Jr, Moore ML, et al. Inhibition of HIV-1 protease in infected T-lymphocytes by synthetic peptide analogues. Nature. 1990; 343:90-2.

2. McQuade TJ, Tomasselli AG, Liu L, Karacostas V, Moss B, Sawyer TK, et al. A synthetic HIV-1 protease inhibitor with antiviral activity arrests HIV-like particle maturation. Science. 1990; 247:454-6.

3. Lambert DM, Petteway SR Jr, McDanal CE, Hart TK, Leary JJ, Dreyer GB, et al. Human immunodefiency virus type 1 protease inhibitors irreversibly block infectivity of purified virions from chronically infected cells. Antimicrob Agents Chemother. 1992; 36:982-8.

4. Roberts NA, Martin JA, Kinchington D, Broadhurst AV, Craig JC, Duncan IB, et al. Rational design of peptide-based HIV proteinase inhibitors. Science. 1990; 248:358-61.

5. Craig JC, Duncan IB, Hockley D, Grief C, Roberts NA, Mills JS. Antiviral properties of Ro 31-8959, an inhibitor of human immunodefiency virus (HIV) proteinase. Antiviral Res. 1991; 16:295-305.

6. Martin JA, Mobberley MA, Redshaw S, Burke A, Tyms AS, Ryder TA. The inhibitory activity of a peptide derivative against the growth of simian immunodefiency virus in C8166 cells. Biochem Biophys Res Commun. 1991; 176:180-8.

7. Kitchen VS, Skinner C, Ariyoshi K, Lane EA, Duncan IB, Burckhardt J, et al. Safety and activity of saquinavir in HIV infection. Lancet. 1996; 345:952-5.

8. Williams PE, Madigen MJ, Mitchel AM. A single dose, randomized crossover study of the absolute and relative bioavailabilty of Ro 31-8959 in healthy volunteers. Roche Reasearch Report. 1992: No. W-141'786.

9. Markowitz M, Mo H, Kempf DJ, Norbeck DW, Bhat TN, Erickson JW, et al. Selection and analysis of human immunodefiency virus type 1 variants with increased resistance to ABT-538, a novel protease inhibitor. J Virol. 1995; 69:701-6.

10. Kaplan AH, Michael SF, Wehbie RS, Knigge MF, Paul DA, Everitt L, et al. Selection of multiple human immunodefiency virus type 1 variants that encode viral proteases with decreased sensitivity to an inhibitor of the viral protease. Proc Natl Acad Sci USA. 1994; 91:5597-601.

11. Patick AK, Rose R, Greytok J, Bechtold CM, Hermsmeier MA, Chen PT, et al. Characterization of a human immunodefiency virus type 1 variant with reduced sensitivity to an aminodiol protease inhibitor. J Virol. 1995; 69:2148-52.

12. Ho DD, Toyoshima T, Mo H, Kempf DJ, Norbeck D, Chen CM, et al. Characterization of human immunodefiency virus type 1 variants with increased resistance to a C2-symmetric protease inhibitor. J Virol. 1994; 68:2016-20.

13. King RW, Garber S, Winslow DL, Reid C, Bacheler LT, Anton E, et al. Multiple mutations in the human immunodefiency virus protease gene are responsible for decreased susceptibility to protease inhibitors. Antiviral Chem Chemother. 1995; 6:80-8.

14. Turriziani O, Antonelli G, Jacobsen H, Mous J, Riva E, Pistello M, et al. Identification of an amino acid substitution involved in the reduction of sensitivity of HIV-1 to an inhibitor of viral proteinase. Acta Virol. 1994; 38:297-8.

15. Jacobsen H, Yasargil K, Winslow DL, Craig JC, Krohn A, Duncan IB, et al. Characterization of human immunodefiency virus type 1 mutants with decreased sensitivity to proteinase inhibitor Ro 31-8959. Virology. 1995; 206:527-34.

16. Maschera B, Furfine E, Blair ED. Analysis of resistance to human immunodefiency virus type 1 protease inhibitors by using matched bacterial expression and proviral infection vectors. J Virol. 1995; 69:5431-6.

17. Eberle J, Bechowsky B, Rose D, Hauser U, von der Helm K, Gurtler L, et al. Resistance of HIV type 1 to protease inhibitor Ro 31-8959. AIDS Res Hum Retroviruses. 1995; 11:671-6.

18. Molla A, Boucher C, Korneyeva M, Gao Q, Schipper P, Lyons N, et al. Evolution of resistance to the protease inhibitor ritonavir (ABT-538) in HIV infected patients [Abstract]. Fourth International Workshop on HIV Drug Resistance, Sardinia, 6-9 July 1995.

19. Mellors JW, McMahon DK, Chodakewitz JA, Schleif WA, Emini EA, Condra JH, et al. Correlation between genotypic evidence of HIV-1 resistance to the protease inhibitor MK-639 and loss of antiretroviral effect in treated patients [Abstract]. Fourth International Workshop on HIV Drug Resistance, Sardinia, 6-9 July 1995.

20. Condra JH, Schleif WA, Blahy OM, Gabryelski LJ, Graham DJ, Quintero JC, et al. In vivo emergence of HIV-1 varients resistant to multiple protease inhibitors. Nature. 1995; 374:569-71.

21. Tisdale M, Myers RE, Maschera B, Parry NR, Oliver NM, Blair ED. Cross-resistance analysis of human immunodefiency virus type 1 variants individually selected for resistance to five different protease inhibitors. Antimicrob Agents Chemother. 1995; 39:1704-10.

22. Roberts NA, Race E, Tomlinson P, Gilbert S, Duncan IB. Resistance and cross resistance issues: studies with saquinavir [Abstract]. In: Program and Abstracts—35th Interscience Conference on Antimicrobial Agents and Chemotherapy, San Francisco, 17-20 September 1995. Washington, DC: American Society for Microbiology; 1995.

23. Collier AC, Coombs RW, Schoenfeld DA, Bassett R, Baruch A, Corey L. Extended treatment with Saquinavir (SAQ), Zidovudine (ZDV) and Zalcitabine (ddC) vs. SAQ and ZDV vs. ddC and ZDV [Abstract]. In: Program and Abstracts—35th Interscience Conference on Antimicrobial Agents and Chemotherapy, San Francisco, 17-20 September 1995. Washington, DC: American Society for Microbiology; 1995.

24. Hollinger FB, Bremer JW, Myers LE, Gold JW, McQuay L. Standardization of sensitive human immunodefiency virus coculture procedures and establishment of a multicenter quality assurance program for the AIDS clinical trials group. The NIH/NIAID/DAIDS/ACTG Virology Laboratories. J Clin Microbiol. 1992; 30:1787-94.

25. Winters MA, Tan LB, Katzenstein DA, Merigan TC. Biological variation and quality control of plasma human immunodefiency virus type 1 RNA quantitation by reverse transcriptase polymerase chain reaction. J Clin Microbiol. 1993; 31:2960-6.

26. Lin HJ, Myers LE, Yen-Lieberman B, Hollinger FB, Henrard D, Hooper CJ, et al. Multicenter evaluation of quantification methods for plasma human immunodefiency virus type 1 RNA. J Infect Dis. 1994; 170:553-62.

27. Wood R, Dong H, Katzenstein DA, Merigan TC. Quatification and comparison of HIV-1 proviral load in peripheral blood mononuclear cells and isolated CD4 plus T cells. J Acquir Immune Defic Syndr. 1993; 6:237-40.

28. Larder BA, Kellam P, Kemp SD. Zidovudine resistance predicted by direct detection of mutations in DNA from HIV-infected lymphocytes. AIDS. 1991; 5:137-44.

29. Kozal MJ, Shafer RW, Winters MA, Katzenstein DA, Merigan TC. A mutation in human immunodefiency virus reverse transcriptase and decline in CD4 lymphocyte numbers in long-term zidovudine recipients. J Infect Dis. 1993; 167:526-32.

30. Boucher CA, Tersmette M, Lange JM, Kellam P, de Goede RE, Mulder JW, et al. Zidovudine sensitivity of human immunodefiency viruses from high-risk, symptom-free individuals during therapy. Lancet. 1990; 336:585-90.

31. Boucher CA, O'Sullivan E, Mulder JW, Ramautarsing C, Kellam P, Darby G, et al. Ordered appearance of zidovudine resistance mutations during treatment of 18 human immunodefiency virus-positive subjects. J Infect Dis. 1992; 165:105-10.

32. Danner SA, Carr A, Leonard JM, Lehman LM, Gudiol F, Gonzales J, et al. A short-term study of the safety, pharmacokinetics, and efficacy of ritonavir, an inhibitor of HIV-1 protease. European-Australian Collaborative Ritonavir Study Group. N Engl J Med. 1995; 333:1528-33.

33. Markowitz M, Saag M, Powderly WG, Hurley AM, Hsu A, Valdes JM, et al. A preliminary study of ritonavir, an inhibitor of HIV-1 protease, to treat HIV-1 infection. N Engl J Med. 1995; 333:1534-9.

34. Fischl MA, Richman DD, Hansen N, Collier AC, Carey JT, Para MF, et al. The safety and efficacy of zidovudine (AZT) in the treatment of subjects with mildly symptomatic human immunodefiency virus type I (HIV) infection. A double-blind, placebo-controlled trial. The AIDS Clinical Trials Group. Ann Intern Med. 1990; 112:727-37.

35. Yarchoan R, Pluda JM, Thomas RV, Mitsuya H, Brouwers P, Wyvill KM, et al. Long term toxicity/activity profile of 2', 3'-dideoxyinosine in AIDS or AIDS related complex. Lancet. 1990; 336:526-9.

36. Merigan TC, Skowron G. Safety and tolerence of dideoxycytidine as a single agent. Results of early-phase studies in patients with acquired immunodeficiency syndrome (AIDS) or advanced AIDS-related complex. Study Group of the AIDS Clinical Trials Group of the National Institute of Allergy and Infectious Diseases. Am J Med. 1990; 88:11S-15S.

37. Kozal MJ, Shafer RW, Winters MA, Katzenstein DA, Merigan TC. A mutation in human immunodefiency virus reverse transcriptase and decline in CD4 lymphocyte numbers in long-term zidovudine recipients. J Infect Dis. 1993; 167:526-32.

38. Richman DD, Grimes JM, Lagakos SW. Effect of stage of disease and drug dose on zidovudine susceptibilities of isolates of human immunodefiency virus. J Acquir Immune Defic Syndr. 1990; 3:743-6.

39. Kozal MJ, Kroodsma K, Winters MA, Shafer RW, Efron B, Katzenstein DA, et al. Didanosine resistance in HIV-infected patients switched from zidovudine to didanosine monotherapy. Ann Intern Med. 1994; 121:263-8.

40. Shafer RW, Kozal MJ, Winters MA, Iversen AK, Katzenstein DA, Ragni MV, et al. Combination therapy with zidovudine and didanosine selects for drug-resistant human immunodefiency virus type 1 strains with unique patterns of pol gene resistance. J Infect Dis. 1994; 169:722-9.

41. Larder BA, Kemp SD, Harrigan PR. Potential mechanism for sustained anti-retroviral efficacy of AZT-3TC combination therapy. Science. 1995; 269:696-9.

Related articles in Annals:

Editorials
Protease Inhibitors for HIV Infection
John G. Bartlett
Annals 1996 124: 1086-1088. [Full Text]  



This article has been cited by other articles:


Home page
Antimicrob. Agents Chemother.Home page
A. Marin-Niebla, L. F. Lopez-Cortes, R. Ruiz-Valderas, P. Viciana, R. Mata, A. Gutierrez, R. Pascual, and M. Rodriguez
Clinical and Pharmacokinetic Data Support Once-Daily Low-Dose Boosted Saquinavir (1,200 Milligrams Saquinavir with 100 Milligrams Ritonavir) in Treatment-Naive or Limited Protease Inhibitor-Experienced Human Immunodeficiency Virus-Infected Patients
Antimicrob. Agents Chemother., June 1, 2007; 51(6): 2035 - 2042.
[Abstract] [Full Text] [PDF]


Home page
Journal of Pharmacy PracticeHome page
N. S. Boston and J. C. Slish
Management of HIV Infection in Persons Co-infected With Hepatitis
Journal of Pharmacy Practice, August 1, 2005; 18(4): 295 - 309.
[Abstract] [PDF]


Home page
J Clin PharmacolHome page
D. S. Stein, Y. Lou, M. Johnson, S. Randall, S. Blanche, and for the Prob2004 Study Team
Pharmacokinetic and Pharmacodynamic Analysis of Amprenavir-Containing Combination Therapy in HIV-1-Infected Children
J. Clin. Pharmacol., November 1, 2004; 44(11): 1301 - 1308.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
L. Ahdieh-Grant, R. Li, A. M. Levine, L. S. Massad, H. D. Strickler, H. Minkoff, M. Moxley, J. Palefsky, H. Sacks, R. D. Burk, et al.
Highly Active Antiretroviral Therapy and Cervical Squamous Intraepithelial Lesions in Human Immunodeficiency Virus-Positive Women
J Natl Cancer Inst, July 21, 2004; 96(14): 1070 - 1076.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. D. Wu, C. A. Schiffer, M. J. Gonzales, J. Taylor, R. Kantor, S. Chou, D. Israelski, A. R. Zolopa, W. J. Fessel, and R. W. Shafer
Mutation Patterns and Structural Correlates in Human Immunodeficiency Virus Type 1 Protease following Different Protease Inhibitor Treatments
J. Virol., April 15, 2003; 77(8): 4836 - 4847.
[Abstract] [Full Text] [PDF]


Home page
Am J EpidemiolHome page
L. Ahdieh-Grant, T. E. Yamashita, J. P. Phair, R. Detels, S. M. Wolinsky, J. B. Margolick, C. R. Rinaldo, and L. P. Jacobson
When to Initiate Highly Active Antiretroviral Therapy: A Cohort Approach
Am. J. Epidemiol., April 15, 2003; 157(8): 738 - 746.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
A. Hsu, J. Isaacson, S. Brun, B. Bernstein, W. Lam, R. Bertz, C. Foit, K. Rynkiewicz, B. Richards, M. King, et al.
Pharmacokinetic-Pharmacodynamic Analysis of Lopinavir-Ritonavir in Combination with Efavirenz and Two Nucleoside Reverse Transcriptase Inhibitors in Extensively Pretreated Human Immunodeficiency Virus-Infected Patients
Antimicrob. Agents Chemother., January 1, 2003; 47(1): 350 - 359.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
C.M.F. Kruijtzer, J.H. Beijnen, and J.H.M. Schellens
Improvement of Oral Drug Treatment by Temporary Inhibition of Drug Transporters and/or Cytochrome P450 in the Gastrointestinal Tract and Liver: An Overview
Oncologist, December 1, 2002; 7(6): 516 - 530.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
S. H. Khoo, P. G. Hoggard, I. Williams, E. R. Meaden, P. Newton, E. G. Wilkins, A. Smith, J. F. Tjia, J. Lloyd, K. Jones, et al.
Intracellular Accumulation of Human Immunodeficiency Virus Protease Inhibitors
Antimicrob. Agents Chemother., October 1, 2002; 46(10): 3228 - 3235.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
P. G. Yeni, S. M. Hammer, C. C. J. Carpenter, D. A. Cooper, M. A. Fischl, J. M. Gatell, B. G. Gazzard, M. S. Hirsch, D. M. Jacobsen, D. A. Katzenstein, et al.
Antiretroviral Treatment for Adult HIV Infection in 2002: Updated Recommendations of the International AIDS Society-USA Panel
JAMA, July 10, 2002; 288(2): 222 - 235.
[Abstract] [Full Text] [PDF]